Stock: w-; sinu[nwu7]/TM6B Hu Sb[1]e Tb[1] ca[1] dfd-lacZ

Bloomington stock 8577

Information for sinu[nwu7]

Constructed by: Alex Hirschi, Victoria Wu, Greg Beitel
Reference: Wu VM, Schulte J, Hirschi A, Tepass U, Beitel GJ. Sinuous is a Drosophila claudin required for septate junction organization and epithelial tube size control. J Cell Biol. 2004 Jan 19;164(2):313-23.
Description:
sinu[nwu7] was generated by imprecise excision of the l(3)06524 transposable element and completely deletes the sinuous coding sequence without deleting any portions of the 5' or 3' flanking genes. The sequence across the deficiency break point is acggttgggcctttt/aagtcagggtcggtc. The deletion can be followed using the primers nwu7 left 5'CCATTCAGACAGCCAGTGACTT3' and nwu7 right 5' AAAAACGTGCACTACCAGAAACTG3'. The product should be 759 bp for the nwu7 deletion chromosome and 1.4 kb for WT.

Information for TM6B Hu Sb[1]e Tb[1] ca[1] dfd-lacZ

Constructed by: Greg Beitel, Alex Hirschi
Reference: Paul SM, Ternet M, Salvaterra PM, Beitel GJ. The Na+/K+ ATPase is required for septate junction function and epithelial tube-size control in the Drosophila tracheal system. Development. 2003 Oct; 130(20):4963-74.
Description:
Balancer has strong expression in head starting stage 11-12. The TM6 Sb dfd lacZ was created by hoping a ry+ Hz2.7 dfd-lacZ insert to TM6B Hu Sb[1]e Tb[1] ca[1]. Hz2.7 was from W. McGinnis and was FBtp0000299. The TM6B was made by Jim Kennison and was obtained from Bloomington stock 3619 (Note the genotype of the TM6B in stock 3619 is missing Hu e).

Back to main Reagents page.